Introduction

Klebsiella pneumoniae is a non-motile, encapsulated, lactose-fermenting, facultative anaerobic, rod-shaped and gram-negative opportunistic pathogen that common cause of nosocomial infections. These bacteria, particularly in children are the cause of pneumonia, meningitis, sepsis, diarrhea and bacteremia (1, 2). The increasing appearance of multidrug resistance (MDR) among K. pneumoniae nosocomial isolates has confined the suitable therapeutic choices for the treatment of this infections (3). Newly, the emergence of new β-lactamases such as NDM-1 (New Delhi metallo-β-lactamase-1), OXA-48 (Oxacillinase-48), OXA-181 (oxacillinase-181), KPC (K. pneumoniae carbapenemase) and CTX-M-15 (Cefotaxime-M-15) admit resistance to the most antibiotics for example penicillins, carbapenems, cephalosporins, and sulfamethoxazole (4,5).

These resistant genes are located on transferable plasmids and can be freely transferred between bacteria, from one region to another and from one country to the other and then spread all over the world (6). Carbapenems are a class of β-Lactam antibiotics with a broad spectrum of antibacterial activity (7). Misuse, overuse and abuse of the carbapenems can increase resistance in the K. pneumoniae carbapenemase (KPC) -producing bacteria (8).

The mechanisms of resistance to carbapenems may be related to the combination of decrease in bacterial outer membrane permeability, increasing production of Extended-Spectrum Beta-Lactamases (ESBLs), AmpC beta-lactamases and expression of betalactamases like Carbapenemases (9,10). The production of carbapenemases especially KPC is the most important mechanism of enzymatic resistance in isolated Enterobacteriaceae such asK. pneumoniae (11). KPCs are encoded by the gene bla-KPC, whose potential for different species and universal spreading is mainly elucidated by its location within a Tn3-type transposon, Tn4401. This transposon is able to inserting into varied plasmids of Gram-negative bacteria. Plasmids carrying bla-KPC are related to resistance factors for other antibiotics (6, 12). Although K.  pneumoniae remains the most prevalent bacterial species carrying KPCs, the enzyme has been identified in several other Gram-negative bacilli (13).

KPC-producing bacteria have initially been reported from the New York City area; however, bla-KPC is present among Enterobacteriaceae isolates in the worlds (14-16). KPCs do not demonstrate the first or the only mechanism of carbapenem resistance, they are notable because they are often not detected by routine susceptibility screening tests and possess an exceptional potential for distribution. As well as, the infection control challenges that have arisen because of limited antibiotic options (17-19). Therefore, detection of KPC-producing bacteria may be difficult based on routine antibiotic susceptibility testing (20). It is essential to implement efficient infection control actions to limit the spread of these pathogens (21).

Considering the fact that information on the subject is limited in our country so utilization of a suitable method for determination of the carbapenemase production is an important point in the microbiology laboratory (8). Therefore, the aim of this study was determination of the KPC-producing K.  pneumoniae isolates by phenotypic and genotypic methods.

Materials and Methods

Bacterial strains

We accomplished a cross-sectional study during, “Sep 2011” to “Jun 2013”, at three large teaching hospitals of Tehran, Iran (Milad, Motahari and Aliasghar). Clinical specimens counting urine, blood, stool, burn wound, sputum, cerebrospinal fluid (CSF), skin lesion, eye discharge, abscess, trachea and catheter were achieved. Identification of K.  pneumoniae doubtful grown colonies were, according to the Gram staining and standard biochemical tests such as indole test, motility, lactose fermentation, citrate and urease test, lysine decarboxylase and MR-VP.

Antimicrobial susceptibility testing and Modified Hodge Test

Susceptibility testing was performed by the using of disk diffusion method with the antibiotic discs MAST Company, UK according to Clinical and Laboratory Standards Institute (CLSI) guideline (22). Antibiotic tested comprise: ertapenem (10µ), imipenem (10µ), meropenem (10µ), cefotaxime (30µ), ceftazidime (30µ), cefepime (30µ), cefoxitine (30µ), ceftriaxone (30µ), gentamicine (10µ), piperacillin (100µ), aztreonam (30µ). Klebsiella pneumoniae ATCC 13883 was used as a control strain for disk susceptibility testing. Ertapenem resistant strains were tested for KPC producing by the Modified Hodge Test (MHT) according to the CLSI recommendation using E. coli ATCC 25922 and the ertapenem disk (Mast, UK). MHT- PositiveK.  pneumoniae ATCC BAA-1705was used as a positive control.

 DNA Extraction

DNA extraction was carried out by boiling method (23). Briefly, K.  pneumoniae strains were grown overnight at 35 °C on MacConkey agar (Merck Co., Germany). Two or three colonies of each culture were harvested from the surface of the agar plates and re -suspended in 200 μl of sterile distilled water. The cell suspension was heated for 15 min at 100 °C and then centrifuged at 10,000 gfor 10 min and used supernatant as a source of template DNA for bla-KPC gene amplification by polymerase chain reaction (PCR).

 Genotypic detection of bla-KPC by PCR

Detection of resistant ertapenem strains for the surveying presence of the bla-KPC gene was performed by PCR using specific primers (24). The bla-KPC  specific primer pairs include forward, 5'- CGTCTAGTTCTGCTGTCTTG -3', and reverse 5'- CTTGTCATCCTTGTTAGGCG -3' (24). A volume of 1.5 μL of ready DNA (0.5 μg) was added to a final volume of 30 μL PCR mixture comprising 12.5 μL of 2× Master Mix (Ampliqon, Denmark), including 1× PCR buffer, 1.5 mmol/L MgCl2, 0.15 mmol/L dNTP, and 1.25 IU Taq DNA polymerase, (Ampliqon Co., Denmark), 0.7 μL of 0.8 μmol/L each primer and 14.6 μL of sterile distilled water. PCR program was performed as follows, 94 °C for 3 min, followed by 30 cycles of 95 °C for 1 min, 55 °C for 31 s and 73 °C for 1 min, with a final extension at 72 °C for 5 min. The PCR products were visualized by electrophoresis in 1.5% agarose gels stained with ethidium bromide.

Results

Overall, 800 clinical samples, 270 K.  pneumonia wereobtained. The distribution of the K.  pneumoniae was, 57% and 43% were collected from the women and men, respectively. The highest and lowest resistance was related to piperacillin (60.6%) and imipenem (13.9%), respectively. Intermediate resistance to meropenem was not observed (0%) and intermediate resistance inhibition zone was similar (1.6%) for cefepime, cefoxitin, ceftriaxone and gentamicine. The highest frequency of susceptibility among K.  pneumonia was associated to meropenem with 85.5%, and the lowest rate of sensitivity was related to piperacillin with 28.2% (Table 1). Out of, 15.1% (41 of 270) strains resistant to carbapenems, 87.8% (36 of 41) strains were isolated from the burn wound and 80.5% (33 of 41) of them were resistant to all tested antibiotics, they could therefore be considered as being multidrug-resistant (MDR) strains. Therefore, 33 strains were positive as KPC producing in MHT by developing clover leaf shape (Fig.1). PCR method was done for identification of KPC producing strains by amplification of bla-KPC gene in forty one carbapenem resistant isolates. The PCR products obtained in this work, revealed that all carbapenem resistant isolates did not carry a bla-KPC gene.

Table 1: Antimicrobial resistance profile of Klebsiella  pneumoniae isolates

ERTA;  Ertapenem, IMP; Imipenem, MER; Meropenem, CTX; Cefotaxime, CFT; Ceftazidime, CP; Cefepime, CFX; Cefoxitin, CF; Ceftriaxone, Gm; Gentamicine, PIP; Piperacillin, Az; Aztreonam.

Fig.1: Isolates tested for KPC production through MHT

Discussion

The gold standard to approve the attendance of a KPC is the spectrophotometry method and then PCR of the bla-KPC gene. This genotypic assay, is time consuming for a clinical microbiology laboratory and commonly needs isolates to be referred to reference laboratories for confirmation. For the recognition of KPCs, have been established several phenotypic tests (12, 25). The method presently approve by the CLSI is the modified Hodge test (MHT) and this method is accepted as a specific and sensitive method for detection of carbapenemase (26, 27). Because of the difficult elucidation and false positive results, MHT cannot be used as a confirmatory test for recognition of the KPCs (28, 29). False-positive results are a more common in isolates producing AmpC and CTX-M b-lactamase (30).

In this study, 14.65% of the K.  pneumoniae strains were resistant to carbapenems. The antibiotic susceptibility test results showed that the highest resistance to the antibiotic were related to gentamicin and cefepime, whereas, the lowest rate was associated to  imipenem, meropenem, ertapenem and ceftazidime, that is agreement with the result of Brato et al. study (31). The highest resistance to the antibiotics was related to gentamicin (26). In the MHT, 80.5% (33 of 41) strains were positive for KPC that was consistent with Cury et al. (MHT 71% positive) (26). In two studies, 84% (32 of 38) and 12.3% (30 of 244) strains showed the production of carbapenemase (8, 17). We showed that all 41 carbapenem – resistant K.  pneumoniae isolates were negative for bla-KPC gene. These results are consistent with Flonta et al. (13) and Anderson and his coworkers (19) studies. Whereas, other studies from the USA (32), China (27) and Italy (17) confirm the presence of thebla-KPC gene by PCR, that having contrast with our study. This contrast can be due to reduced susceptibility to at least one extended-spectrum cephalosporin (22) and another mechanism such as of carbapenem resistance as a result of a combination of an ESBL or AmpC-type enzyme with porin loss (33,34). Woodford and his colleague declare that non-susceptibility to ertapenem is not reason for carbapenemase production, particularly when carbapenemase production is unusual (35).

In this study, the MHT was a suitable method for approving carbapenemase production. Moreover, a laboratory could approve the carbapenemase production with PCR method for the bla-KPC gene, which has the added profit of endorsing which KPC is present.

Conclusion

The accurate cure of infections caused by KPC-producing isolates is uncertain. The evolution of antibiotic resistance mechanisms and the lack of antimicrobial agents against gram negative bacteria is a main treatment problem for clinicians. It is vital for laboratories are alert about the recognition of appearance KPC resistance. Approaches to laboratory recognition of KPC resistance will probably have to be revised and adjusted as a more studied. We hope the results of this study be useful for application of an effective infection disease control approach to avoid and decrease the prevalence of KPC-producing K.  pneumoniae in Iran.

Acknowledgment

The author would like to thank to Sattarzadeh M, Rahmani S, Nazarifar T for their assistance and cooperation in this project.

Conflict of interest

the authors declare that there is no conflict of interests.

How to cite this article:
Bina M, Pournajaf A, Mirkalantari S, Talebi M, Irajian G. Detection of the Klebsiella pneumoniae carbapenemase (KPC) in K. pneumoniae Isolated from the Clinical Samples by the Phenotypic and Genotypic Methods. Iran J Pathol. 2015;10(3):199-205.