Iranian Journal of Pathology

JAK2, CALR, and MPL Mutation Profiles in BCR-ABL Negative Myeloproliferative Neoplasms, a Referral Center Experience in the Middle East

Document Type : Original Research

Authors

Moeinadin Safavi 1
Ahmad Monabati 2, 3
Akbar Safaie 2
Maryam Mirtalebi 3
Masoumeh Faghih 2

1 Molecular Pathology and Cytogenetic Section, Department of Pathology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

2 Molecular Pathology and Cytogenetic Section, Department of Pathology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran

3 Hematology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran

https://doi.org/10.30699/ijp.2021.136458.2495
Abstract
Background: This study was conducted to evaluate the frequency of JAK2, CALR and MPL mutations in with BCR-ABL myeloproliferative neoplasms and their association with demographic data and hematologic parameters in a referral center, in the Middle East.
Methods: Seventy-one patients with BCR-ABL negative myeloproliferative neoplasms were evaluated for JAK2 V617F, CALR type 1, type 2, and MPL by allele-specific PCR and conventional PCR from 2018 to 2019.
Results:  Twenty three patients were categorized as polycythemia vera and demonstrated JAK2 V617F in 91.3 % of these cases. Thirty-eight patients were classified as essential thrombocythemia and showed JAK2 V617F in 52.6%, CALR type 1 in 18.4%, CALR type 2 in 7.9% and no mutation in 21.1%. Seven patients were recognized as primary myelofibrosis and exhibited JAK2 V617F mutation in 57.1%, CALR type 1 in 14.3 %, CALR type 2 in 14.3% and no mutation in 14.3%. Three patients were diagnosed as MPN, unclassifiable and revealed JAK2 V617F mutation in 33.3% and no mutation in 66.6%.The age (59.15±13.10) and neutrophil percent (70.78±10.14) were higher in patients with JAK2 mutation compared to other mutations (p=0.000, and p=0.03). Platelet count was significantly higher in patients with CALR type 1 mutation (1240400± 402053) (p=0.000).
Conclusion: JAK2 V617F was was associated with patients’ higher age and higher neutrophil count in CBC. CALR mutation had an association with higher platelet count. No MPL mutation was found in this study and it seems that its frequency is lower than what is expected in this region.

Keywords

CALR
JAK2
MPL
MPN

Subjects

Introduction

 

Myeloproliferative neoplasms (MPN) are characterized by clonal myeloid cell proliferation, bone marrow fibrosis, and peripheral blood abnormalities. The World Health Organization (WHO) provides diagnostic criteria for BCR-ABL negative MPNs, including polycythemia vera (PV), essential thrombocythemia (ET), primary myelofibrosis (PMF), chronic eosinophilic leukemia (CEL), chronic neutrophilic leukemia (CNL), and myeloproliferative neoplasms, unclassifiable (MPN-U) (1).

 

Common molecular disorders in MPN include mutations in the JAK2, MPL, and CALR gene. JAK2 V617F mutation was discovered as a driver mutation in MPN patients in 2005 and became a research hotspot since then. The JAK2 gene produces the Janus kinase 2 protein that takes part in the JAK-STAT signaling pathway and affects cellular proliferation and differentiation. Exon 10 mutations in the MPL gene are used as one of the diagnostic criteria. MPL is the receptor of thrombopoietin and has a pivotal role in megakaryopoiesis and platelet production (1-5). Recently, frameshift mutations related to exon 9 of the CALR gene using next-generation sequencing have been found in patients with ET and PMF who do not have the MPL or JAK2 mutation. CALR is a multi-task protein with several roles including calcium equilibrium regulation, cell proliferation, differentiation, and apoptosis (5-7).

 

 

 

Due to the different frequency of JAK2, MPL, CALR mutations and the difference in the course of myeloproliferative neoplasms with different mutations and considering that a comprehensive study has not been established in the Iranian population about myeloproliferative neoplasms and these mutations so far, this study was conducted in a referral center in the southwest of Iran, the Middle East.

 

 

 

Materials and Methods

Seventy-one patients with BCR-ABL negative myeloproliferative neoplasms whose information was registered in the molecular pathology department of Shiraz Medical School, the southwest of Iran, were included in this study from 2018 to 2019. Patients’ demographic data (like age and sex) and hematologic characteristics of myeloproliferative neoplasms (like hemoglobin level, leukocytosis, and platelet count) were extracted from the database registered in the department of molecular pathology.

The presence of JAK2, CALR and MPL gene mutations was detected by allele-specific PCR and conventional PCR. An allele-specific PCR was applied for detection of JAK2 V617F mutation using two forward primers and a reverse primer with the following sequences: Forward (specific):5′AGCATTTGGTTTT AAATTATGGAGTATATT3′, Forward (internal control): 5′ATCTATAGTCATGCTGAAAGTAGGAGAAAG3′, Reverse:5′CTGAATAGTCCTACAGTGTTTTCAGTTTCA3′. Five μL of patient's DNA was amplified by 1 μL of reverse primer and 0·5 μL of each forward primers at an annealing temperature of 58°C during 35 cycles of PCR. The final product was run on a 2% agarose gel and a 203-bp band was considered as a positive result and the 218 bp band was considered as the internal control (8).

CALR type 1 and type 2 mutations were evaluated by prim

  1. Swerdlow SH, Campo E, Harris NL, et al, eds. World Health Organization Classification of Tumours of Haematopoietic and Lymphoid Tissues. Lyon, France: IARC Press; 2016.
  2. Scott LM, Tong W, Levine RL, et al. JAK2 exon 12 mutations in polycythemia vera and idiopathic erythrocytosis. N Engl J Med. 2007;356:459-68. [DOI:10.1056/NEJMoa065202] [PMID] [PMCID]
  3. Pikman Y, Lee BH, Mercher T, et al. MPLW515L is a novel somatic activating mutation in myelofibrosis with myeloid metaplasia. PLoS Med. 2006;3:e270 [DOI:10.1371/journal.pmed.0030270] [PMID] [PMCID]
  4. Jones AV, Kreil S, Zoi K, et al. Widespread occurrence of the JAK2 V617F mutation in chronic myeloproliferative disorders. Blood. 2005;106:2162-8. [DOI:10.1182/blood-2005-03-1320] [PMID]
  5. Lang T, Nie Y, Wang Z, Huang Q, An L, Wang Y, Wufuer G, Maimaiti A, Fu L, Li Y, Zhang X. Correlation analysis between JAK2, MPL, and CALR mutations in patients with myeloproliferative neoplasms of Chinese Uygur and Han nationality and their clinical characteristics. Journal of International Medical Research. 2018 Nov;46(11):4650-9. [DOI:10.1177/0300060518787719] [PMID] [PMCID]
  6. Nangalia J, Massie CE, Baxter EJ, et al. Somatic CALR mutations in myeloproliferative neoplasms with nonmutated JAK2. N Engl J Med. 2013;369:2391-405 [DOI:10.1056/NEJMoa1312542] [PMID] [PMCID]
  7. Klampfl T, Gisslinger H, Harutyunyan AS, et al. Somatic mutations of calreticulin in myeloproliferative neoplasms. N Engl J Med. 2013;369:2379-2390. [DOI:10.1056/NEJMoa1311347] [PMID]
  8. Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N, Swanton S, Vassiliou GS, Bench AJ, Boyd EM, Curtin N, Scott MA. Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. The Lancet. 2005 Mar 19;365(9464):1054-61. [DOI:10.1016/S0140-6736(05)71142-9]
  9. Jeong JH, Lee HT, Seo JY, Seo YH, Kim KH, Kim MJ, Lee JH, Park J, Hong JS, Park PW, Ahn JY. Screening PCR versus Sanger sequencing: detection of CALR mutations in patients with thrombocytosis. Annals of laboratory medicine. 2016 Jul 1;36(4):291-9. [DOI:10.3343/alm.2016.36.4.291] [PMID] [PMCID]
  10. Chen X, Qi X, Tan Y, Xu Z, Xu A, Zhang L, Wang H. Detection of MPL exon10 mutations in 103 Chinese patients with JAK2V617F-negative myeloproliferative neoplasms. Blood Cells, Molecules, and Diseases. 2011 Jun 15;47(1):67-71. [DOI:10.1016/j.bcmd.2011.04.004] [PMID]
  11. Kim SY, Im K, Park SN, Kwon J, Kim JA, Lee DS. CALR, JAK2, and MPL Mutation Profiles in Patients With Four Different Subtypes of Myeloproliferative Neoplasms Primary Myelofibrosis, Essential Thrombocythemia, Polycythemia Vera, and Myeloproliferative Neoplasm, Unclassifiable. American journal of clinical pathology. 2015 May 1;143(5):635-44. [DOI:10.1309/AJCPUAAC16LIWZMM] [PMID]
  12. Lin X, Huang H, Chen P. Retrospective analysis of the clinical features of 172 patients with BCR-ABL1-negative chronic myeloproliferative neoplasms. Molecular Cytogenetics. 2020 Dec;13(1):1-7. [DOI:10.1186/s13039-020-0471-z] [PMID] [PMCID]
  13. Tefferi A, Wassie EA, Guglielmelli P, et al. Type 1 vs type 2 calreticulin mutations in essential thrombocythemia: a collaborative study of 1027 patients. Am J Hematol. 2014;89:E121-E4. [DOI:10.1002/ajh.23743] [PMID]
  14. Tefferi A, Lasho TL, Finke C, et al. Type 1 vs type 2 calreticulin mutations in primary myelofibrosis: differences in phenotype and prognostic impact. Leukemia. 2014;28:1568-1570. [DOI:10.1038/leu.2014.83] [PMID]
  15. Cazzola M, Kralovics R. From Janus kinase 2 to calreticulin: the clinically relevant genomic landscape of myeloproliferative neoplasms. Blood. 2014;123:3714-3719. [DOI:10.1182/blood-2014-03-530865] [PMID]
  16. Rumi E, Pietra D, Ferretti V, et al. JAK2 or CALR mutation status defines subtypes of essential thrombocythemia with substantially different clinical course and outcomes. Blood. 2014;123:1544-1551. [DOI:10.1182/blood-2013-11-539098] [PMID] [PMCID]
  17. Rotunno G, Mannarelli C, Guglielmelli P, et al. Impact of calreticulin mutations on clinical and hematological phenotype and outcome in essential thrombocythemia. Blood. 2014;123:1552-1555. [DOI:10.1182/blood-2013-11-538983] [PMID]
  18. Lin Y, Liu E, Sun Q, Ma J, Li Q, Cao Z, Wang J, Jia Y, Zhang H, Song Z, Ai X. The Prevalence of JAK2, MPL, and CALR Mutations in Chinese Patients With BCR-ABL1-Negative Myeloproliferative Neoplasms. American journal of clinical pathology. 2015 Jul 1;144(1):165-71. [DOI:10.1309/AJCPALP51XDIXDDV] [PMID]
  19. Mejía-Ochoa M, Toro PA, Cardona-Arias JA. Systematization of analytical studies of polycythemia vera, essential thrombocythemia and primary myelofibrosis, and a meta-analysis of the frequency of JAK2, CALR and MPL mutations: 2000-2018. BMC cancer. 2019 Dec 1;19(1):590. [DOI:10.1186/s12885-019-5764-4] [PMID] [PMCID]
  20. Fu R, Xuan M, Zhou Y, et al. Analysis of calreticulin mutations in Chinese patients with essential thrombocythemia: clinical implications in diagnosis, prognosis and treatment. Leukemia. 2014;28:1912-1914. [DOI:10.1038/leu.2014.138] [PMID]
  21. Lundberg P, Karow A, Nienhold R, et al. Clonal evolution and clinical correlates of somatic mutations in myeloproliferative neoplasms. Blood. 2014;123:2220-8. [DOI:10.1182/blood-2013-11-537167] [PMID]
Iranian Journal of Pathology
Volume 16, Issue 2
Spring 2021
Pages 190-194

  • Receive Date 14 September 2020
  • Revise Date 26 December 2020
  • Accept Date 10 June 2021

Home

Guide for Authors

Submit Manuscript

Contact Us