blaVIM and blaIMP Genes Detection in Isolates of Carbapenem Resistant P. aeruginosa of Hospitalized Patients in Two Hospitals in Iran

Document Type: Short Communication

Authors

1 Department of Pathology, Modarres Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran

2 Department of Microbiology, Shahid Beheshti University of Medical Sciences, Tehran, Iran

3 Shahid Modarres Clinical research and Development center, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Abstract

Background & objective: Beta-lactam antibiotics resistance specifically Imipenem and Meropenem, the last choices of treatment, causes fatal events in patients with P.aeruginosa infection. The aim of this study was to detect the VIM and IMP of metallo-beta-lactamase genes in 103 isolates of P. aeruginosa in two Iranian hospitals.
Methods: In this study, we evaluated the susceptibility of P. aeruginosa to a range of β-lactam antibiotics using disk diffusion method as a standard biochemical test. Combined disk test of Imipenem (IMP) and Imipenem plus Ethylenediaminetetraacetic acid (EDTA) was performed as a phenotypic method to find metallo-beta-lactamase producing isolates.Using conventional PCR method; we evaluated VIM and IMP of metallo-beta-lactamase (MBL) genes in 103 isolates of P.aeruginosa.
Results: Twenty six (25.2%) out of 103 isolates were resistant to Imipenem and 26 (25.2%) to Meropenem. Among 26 Imipenem and Meropenem-resistant strains (25.2%), 19 cases (73.0%) were MBL producing. Using PCR method, we detected the blaVIM and blaIMP genes in 6 (5.8%) and 2(1.9%) of 19 MBL producing isolates, respectively. 
Conclusions: Evaluation  of  these  carbepenemases genes improve epidemiologic researches and also, can  be  used  as  a  diagnostic  tool  for discriminating  between  antibiotics  resistant  and  sensitive  strains  of P.aeruginosa as well as follow-up the patients after treatment.

Keywords

Main Subjects


Introduction

P. aeruginosa is  known  as  one  of  the  most  important  species  of Pseudomonadaceae  family  and  a  common  type  of  nosocomial  pathogens  with  high mortality, mostly in immunocompromised patients(1, 2). The development of resistance to many antibiotics is the reason of high mortality rate particularly in healthcare (2).  The most potent anti pseudomonal drugs are carbapenems including Meropenem (MEM) and Imipenem (IPM) that often administered  as the last choice of treatment  in  patients infected by multi- β-lactam-resistant pseudomonas(3). Beta-lactam antibiotics  is  hydrolyzed  by  a  various  group  of  metallo-enzymes  called Metallo-β-Lactamase  (MBLs) because  of  inserting  MBLs  encoding  genes  in  integrons and  plasmids so, they  have  raised  a  serious  problem  in  treatment  of  multi-resistant P.aeruginosa in hospitals (4). Important types of MBLs in Pseudomonas spp. include IMP, VIM, SPM, GIM, AIM, DIM, NDM and SIM type carbapenemases(5, 6). 

The suitable treatment and monitoring the spread of P.aeruginosa require evaluation of different factors.  One of the most significant subjects is finding the beta lactamase producing isolates, specifically carbapenemase producing strains.  The aim of this study was to find outblaVIM and blaIMP genes in 103 isolates of P.aeruginosa in a cohort of hospitalized patients from 2011 and 2012 in two Iranian hospital.

Materials and Methods

Patients’ characteristics

One hundred and three isolates from patients infected with P.  aeruginosa in  ShahidModarres  and  Milad  hospitals  from  2011  and  2012  were  included  in  this  study. Demographic and clinical data were recorded.

Microbial-resistance phenotypic evaluation 

 Antibiotic-resistant cultures of samples were identified and confirmed by standard biochemical tests.  Antibiotic susceptibility test was  done using gel  disk  diffusion method  according  to  the  Clinical  and  Laboratory  Standards  Institute  (CLSI 2012).  This test was done for antibiotics includingImipenem (10 µg), Meropenem (10 µg), Ticarcillin (75 µg), Ceftazidime (30 µ), Cefepime (30 µg) and Piperacillin (100 µg) (ROSCO Diagnostica, Taastrup, Denmark). A  standard  microbial  suspension  equal  to  0.5  McFarland  turbidity  standards  was prepared. The samples were cultured in the Mueller Hinton Agar medium using a sterile swab.

The carbapenem-resistant isolates were more evaluated by combined disk test with Imipenem (IMP) and Imipenem plus Ethylenediaminetetraacetic acid (EDTA) as inhibitor of MBLs .The presence of a distorted inhibition zone around IMP-EDTA in comparison with IMP after overnight incubation was interpreted as a positive test result. An  Imipenem  disk (10 µg)and  a  prepared  IMP-EDTA  disk  (containing  10  µg Imipenem  and  750µg  EDTA)  were  placed  with an appropriate  distance  on  a  plate containing agar gel and carbapenem-resistant isolates.  After 16-18 hours incubation of the plates at 37 ºC the zone diameter surround the disks were measured. A zone of equal to more than 7mm in the presence of 750 µg of EDTA compared to Imipenem disk alone was considered as a positive test for recognizing the MBL-producing resistant bacteria.

blaVIM and blaIMP gene Detection

The DNA extraction for isolates of P.aeruginosa was performed using a DNA Extraction Kit (Invitek, Germany).

Polymerase chain reaction

To perform PCR, 50ng DNA template was added to 25 μL of PCR mixture including 0.8 mM MgCl2, 200 μMdNTP, 10 pM of each primer containing:

VIM Primer:  GTT  TGG TCG  CAT  ATC  GCA  AC  AAT  GCG  CAG  CAC  CAG  GAT  AG, 

IMP  primer: CTACCGCAGCAGAGTCTTTGC  GAACAACCAGTTTTGCCTTACC  (Metabion, Germany),  and  0.5  U  Taq  DNA  polymerase(Roche,  Mannheim,  Germany) (7). Thermocycler was used for DNA amplification (Techne, TC 512, UK).  PCR procedure was as follows: 94°C for 2 minutes, 94°C for 1minute for 30 cycles, 55°C for 1 minute, 72°C for 1 minute, and 72°C for 10 minutes as final extension phase. The PCR product was mixed with 1 μL of loading buffer (×6) and subjected to gel electrophoresis on 1% agarose in a TAE buffer. After staining with ethidium bromide and visualizing amplicons by a Gel Documentation System, they were compared with a 100 bp ladder (7). (Fig 1)

Figure 1. PCR for blaVIM gene. Gel electrophoresis showing positive and negative isolates. The DNA ladder in the right end of picture. The patient NO.110 has a band in 500 Kbp position which is the site of blaVIM gene. ( The DNA ladder is made of bands with 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500 bp from bottom to the top).

Results

In this study, the mean age of the patients was 49.98± 22.84 (Min=1y, Max=88y) with a gender distribution of 44.3% male and 55.7% female. Antibiotic-resistant cultures and subsequent molecular analysis were carried on samples of urine (n=60, 58.3%), respiratory tract (n=19, 18.4%), blood (n=6, 5.8%), phlegm (n=4, 3.9%) and the other sites (n=14, 13.6%).

The frequency of resistance to different antibiotics was as follows: Imipenem (n=26, 25.2%), Meropenem (n=26, 25.2%), Ticarcillin (n=25, 24.3%), Ceftazidime (n=23, 22.3%), Cefepime (n=21, 20.6%) and Piperacillin (n=21, 20.4%). Among 103 isolates, 33% ( n=34)  were  resistant  to  at  least  one  of  the  mentioned  antibiotics. Sixteen patients (15.5%) with P. aeruginosa infection were multi-resistant to all above antibiotics. In our study from 26 Imipenem and Meropenem- resistant's isolates, 19 (73.0%) produce MBL with combined disk test. From 19 MBL producing isolates, 6 (31.5%) samples had blaVIM gene and 2 (10.5%) had blaIMP gene. Also, PCR for blaVIM and blaIMP was performed for 84 out of 103 isolates that are not resistant to carbapenemes and none of them show positivity for these genes. All of VIM-type carbapenemase positive samples (n=6, 100%) were isolated from urine.

Discussion

MBL-producing strains of P.aeruginosa in  hospitalized  patients  are  considered  as  a reason of  spreading  the  nocosomial  infections  in  healthcare  settings  and  a major problem of physicians in the last decades (8, 9). An important problem of this organism is the development of drug resistance mechanisms. Some mechanism of resistance is including, efflux pumps, inactivation and modification of antibiotics, low permeability of the outer-membrane (10, 11). According to the reports, different strains of P .aeruginosa produce various amounts of MBL. It is so important concerning the association of serum MBL levels  to  the  development  of resistance  to  antibacterial  antibiotics  like  imipenem, meropenem, anti pseudomonal cephalosporins  and penicillin (12).  In our study, 19(18.4%)  of  isolates  were  MBL  producer,  thus  resistant  to  antibacterial  antibiotics mostly imipenem. 

In this study, the most common sources of isolating P.aeruginosa infection were  urine  ,  respiratory  tract  (sputum)  and  blood,  respectively,  while  Van  der  et  al showed the high to low frequency of bacteria in respiratory tract, urine, blood, bone, soft tissue and abdominal  samples,  sequentially (13). In another study in South  Africa, P. aeruginosa sources were  indicated  as  blood,  feces,  bile  and  urine,  in  rank (14)which they are inconsistent with our findings. We also found six positive blaVIM and two blaIMP positive isolates among all samples.  In contrast, Khosravi et al found no IMP carbapenemase-positive cases in MBL-producer P.aeroginosa (8). In a survey among burned patients, 57.9% of separated non-susceptible P. aeruginosa strains were MBL producers. All of these isolates show positivity for blaIMP-1 genes and none of them were positive for blaVIM genes (15). These findings are also in contrast with our findings.

According  to  the  study  of  Hirakata  in  Japan,  the  mortality  of  patients infected  by  IMP-positive P.aeruginosa was  higher  than  those  contaminated  by  IMP-negative  strains (16). Fortunately, the frequency of IMP producing isolates was lower than VIM in the present study.

Yousefiet al showed that 17.31% of imipenem-resistant P.aeruginosa, had blaVIM gene in the samples taken from the patients in the northwest of Iran (17), which was somehow  similar  to  our  results.  In another study reported by Shahcheraghiet  al,  they  detected  the  blaVIM gene  in  16  of  68  imipenem-resistant isolates (7)

The major difference between this study and the other similar researches is evaluating blaVIM gene and blaIMP genes in all of 103 pseudomonas strains in our study. In the present study, we could not find the blaIMP and blaVIM genes in antibiotic-susceptible isolates, indicating the functional activity of responsible agents to create a resistant phenotype in bacteria.

Similar to our conclusion,  MBL  were  identified  in  10.8%  of  415  isolates  with  a  considerable  raise  in VIM  prevalence in  a  cohort  study  in  Korea (18).  Cornaglia  et  al  in  Italy  detected  VIM-1 MBL  gene  in  all  8  strains  of  carbapenem  resistant P. aeruginosa(19). Higher percentage of VIM expression (35%) than our study has been also reported (13). Jacobson et alcould noticeably find VIM-2 gene in all 11 strains of drug resistant P.aeruginosa strains that they examined (14).

Although there are less than 40% similarity between the IMP and VIM carbapenemase, their  kinetic  features  for  inactivating  the beta-lactams,  but  not  monobactam,  are  the same (12). In  the  worldwide,  blaVIM  is  a  dominant  gene  which  is  related  to  the prevalence of nocosomial MBL-producing P. aeruginosa.

Conclusion

In conclusion, the identification of carbapenemases in the antibiotic-resistant strains  of  P.aeruginosa may  be  a  promising  solution  for  the  control  of infection especially in hospitalized patients using the new treatment protocols.

Acknowledgement

The research project was supported financially by Clinical research and Development center, Shahid Modarres Hospital affiliated to Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Declaration of interest

To the best of our knowledge, no conflict of interest, financial or other, exists.